Viously described [18]. Adhesion assay: 100 000 (BxPC3, HPAF-II, and PANC1) or 250 000 cells (H6c7KrT) cells were seeded onto a 24-well dish coated with fibronectin and collagen (Sigma Aldrich, Mississauga, Canada) for 30 minutes (BxPC3, HPAF-II, and PANC1) or 45 minutes (H6c7KrT). The wells were stained with 0.2 crystal violet and lysed with 0.1 Triton X-100. The lysate was read at 590 nm on a Tecan XFlour4 plate reader (Mannedorf, Switzerland). Propidium iodide (Sigma Aldrich, St. Louis, MO) exclusion assay: 2.56105 cells were seeded on 6-well dishes treated with 10 mM gemcitabine or PBS for 72 hours. Live cells were resuspended in PBS supplemented with 0.5 BSA and 1 mg/ml PI, and analyzed by flow cytometry on a Becton Dickenson FACScan (Mississauga, Canada). To assess half maximal inhibitory concentrations (IC50), cells were grown in increasing concentrations of gemcitabine at 0, 0.001, 0.01, 0.1, 1, 5, 10, 20, 50, and 100 mM for 48 hours. Cell viability was assessed by MTS assay (Promega, Madison, WI). Wound healing assay: 2.56105 cells were seeded on 6-well dishes once cells and were serum Indolactam V starved upon confluence. The confluent cell layer was wounded and images were taken at 0, 24, and 48 hours to assess motility.TATGGTGTTCTTCAA, LCN2KD2: AACCTCCGTCCTGTTTAGGAAA, LCN2KD3: GAGTTCACGCTGGGCAACATTA, and non-silencing control siRNA
sequence: TTCTCCGAACGTGTCACGT (Qiagen, Dusseldorf, Germany). The shRNA retroviral expression vectors were generated using Phoenix-amphotropic packaging cell line (ATCC). The LCN2 expression construct was generated using our modified Gateway recombination cloning system [19]. LCN2 cDNA was reversed transcribed from the BxPC3 mRNA and amplified using the Platinum Pfx DNA polymerase (Invitrogen, Burlington, Canada) and gene specific primers (F: 59CTGCCGCACCAGCCCGAAAGGCGCGCCT39; R: 39GACGGCGTGGTCGGGCTTTCCGCGCGGA59). The amplicon was subcloned into an entry vector pENTR-CMVON plasmid after linearization with AscI and SwaI restriction enzymes (New England Biolabs), which then underwent recombination with a lentiviral plko.YFP destination vector using LR Clonase II (Invitrogen). The resulting plko.YFPLCN2 vector was stably transduced by lentiviruses.Immunoblot and Gelatin ZymographyImmunoblotting was performed as described previously [18]. The primary antibodies used included total and cleaved caspase-3 (Asp175) and GAPDH (Cell Signaling, Danvers, MA); and LCN2 (catalogue no. AF1757, R D Systems Minneapolis, MN). 58-49-1 chemical information Visualization was accomplished by HRP-linked anti-rabbit, antimouse (Cell Signaling), and anti-goat secondary
antibodies (Santa Cruz Biotechnology Inc, Santa Cruz, CA). Visualization was achieved by ECL-Plus detection kit (GE Healthcare, Baie d’Urfe, Canada) on a Typhoon phospho- and fluorescent imaging system 9400 (GE Healthcare). Gelatin zymography was performed on conditioned media and protein extracts from xenografts as previously described [20]. Resulting blots and gels were analyzed with ImageJ software (NIH, Bethesda, MA).Quantitative PCRTotal RNA isolation and PCR was performed as described before [18]. Primer sequences are provided in Table S4.LCN2 mRNA Silencing and OverexpressionLCN2 expression was stably downregulated by shRNA retroviral transduction method. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Pickering, Canada). The shRNA oligonucleotides used were: LCN2KD1: CGCATGC-Animal WorkAll studies were.Viously described [18]. Adhesion assay: 100 000 (BxPC3, HPAF-II, and PANC1) or 250 000 cells (H6c7KrT) cells were seeded onto a 24-well dish coated with fibronectin and collagen (Sigma Aldrich, Mississauga, Canada) for 30 minutes (BxPC3, HPAF-II, and PANC1) or 45 minutes (H6c7KrT). The wells were stained with 0.2 crystal violet and lysed with 0.1 Triton X-100. The lysate was read at 590 nm on a Tecan XFlour4 plate reader (Mannedorf, Switzerland). Propidium iodide (Sigma Aldrich, St. Louis, MO) exclusion assay: 2.56105 cells were seeded on 6-well dishes treated with 10 mM gemcitabine or PBS for 72 hours. Live cells were resuspended in PBS supplemented with 0.5 BSA and 1 mg/ml PI, and analyzed by flow cytometry on a Becton Dickenson FACScan (Mississauga, Canada). To assess half maximal inhibitory concentrations (IC50), cells were grown in increasing concentrations of gemcitabine at 0, 0.001, 0.01, 0.1, 1, 5, 10, 20, 50, and 100 mM for 48 hours. Cell viability was assessed by MTS assay (Promega, Madison, WI). Wound healing assay: 2.56105 cells were seeded on 6-well dishes once cells and were serum starved upon confluence. The confluent cell layer was wounded and images were taken at 0, 24, and 48 hours to assess motility.TATGGTGTTCTTCAA, LCN2KD2: AACCTCCGTCCTGTTTAGGAAA, LCN2KD3: GAGTTCACGCTGGGCAACATTA, and non-silencing control siRNA sequence: TTCTCCGAACGTGTCACGT (Qiagen, Dusseldorf, Germany). The shRNA retroviral expression vectors were generated using Phoenix-amphotropic packaging cell line (ATCC). The LCN2 expression construct was generated using our modified Gateway recombination cloning system [19]. LCN2 cDNA was reversed transcribed from the BxPC3 mRNA and amplified using the Platinum Pfx DNA polymerase (Invitrogen, Burlington, Canada) and gene specific primers (F: 59CTGCCGCACCAGCCCGAAAGGCGCGCCT39; R: 39GACGGCGTGGTCGGGCTTTCCGCGCGGA59). The amplicon was subcloned into an entry vector pENTR-CMVON plasmid after linearization with AscI and SwaI restriction enzymes (New England Biolabs), which then underwent recombination with a lentiviral plko.YFP destination vector using LR Clonase II (Invitrogen). The resulting plko.YFPLCN2 vector was stably transduced by lentiviruses.Immunoblot and Gelatin ZymographyImmunoblotting was performed as described previously [18]. The primary antibodies used included total and cleaved caspase-3 (Asp175) and GAPDH (Cell Signaling, Danvers, MA); and LCN2 (catalogue no. AF1757, R D Systems Minneapolis, MN). Visualization was accomplished by HRP-linked anti-rabbit, antimouse (Cell Signaling), and anti-goat secondary antibodies (Santa Cruz Biotechnology Inc, Santa Cruz, CA). Visualization was achieved by ECL-Plus detection kit (GE Healthcare, Baie d’Urfe, Canada) on a Typhoon phospho- and fluorescent imaging system 9400 (GE Healthcare). Gelatin zymography was performed on conditioned media and protein extracts from xenografts as previously described [20]. Resulting blots and gels were analyzed with ImageJ software (NIH, Bethesda, MA).Quantitative PCRTotal RNA isolation and PCR was performed as described before [18]. Primer sequences are provided in Table S4.LCN2 mRNA Silencing and OverexpressionLCN2 expression was stably downregulated by shRNA retroviral transduction method. The shRNA sequences were ligated into the pSUPER GFP retrovirus vector after linearization with BglII and HindIII (New England Biolabs, Pickering, Canada). The shRNA oligonucleotides used were: LCN2KD1: CGCATGC-Animal WorkAll studies were.